1. Definition and Biological Significance

Translation is the process of protein synthesis where the genetic information stored in $mRNA$ is decoded by ribosomes to assemble a specific sequence of amino acids into a polypeptide chain [Per the Central Dogma of Molecular Biology]. This process occurs in the cytoplasm for prokaryotes and in the cytoplasm/rough endoplasmic reticulum for eukaryotes.

2. The Molecular Machinery

The translation process requires the following components:

• mRNA: Provides the template containing codons.
• Ribosomes: The catalytic site for protein synthesis (composed of $rRNA$ and proteins).
• tRNA (Transfer RNA): Acts as an adaptor molecule, possessing an anticodon that base-pairs with the $mRNA$ codon and carries the specific amino acid.
• Aminoacyl-tRNA synthetase: Enzymes responsible for "charging" the $tRNA$ with the correct amino acid [ATP-dependent activation].

3. Sequential Steps of Translation

Step A: Activation of Amino Acids (Charging of tRNA)

Amino acids are activated in the presence of $ATP$ and linked to their cognate $tRNA$ by aminoacyl-tRNA synthetase. This creates a charged $tRNA$ molecule, ensuring specificity [Amino acid + ATP + tRNA $\xrightarrow{Synthetase}$ Aminoacyl-tRNA complex + AMP + PPi].

Step B: Initiation

The ribosome binds to the $mRNA$ at the start codon ($AUG$). The small ribosomal subunit recognizes the $mRNA$ and binds to the initiator $tRNA$ carrying methionine ($Met$). The large subunit then joins the complex, forming the functional $70S$ (or $80S$) initiation complex.

Step C: Elongation

The ribosome moves along the $mRNA$ in the $5' \rightarrow 3'$ direction. Sequential amino acids are added as follows:

1. The second charged $tRNA$ enters the ribosome at the $A$-site.
2. A peptide bond is formed between the carboxyl group of the amino acid in the $P$-site and the amino group of the amino acid in the $A$-site [Catalyzed by 23S rRNA/Peptidyl transferase].
3. Translocation occurs: The ribosome shifts one codon down the $mRNA$, moving the $tRNA$ from the $A$-site to the $P$-site, ejecting the spent $tRNA$ from the $E$-site.

Step D: Termination

Termination occurs when the ribosome encounters one of the three stop codons ($UAA, UAG, UGA$). No $tRNA$ recognizes these codons; instead, a Release Factor binds to the $A$-site, causing the dissociation of the polypeptide chain and the ribosomal subunits from the $mRNA$.

4. Schematic Representation of Translation

Final Solution: Translation is the biological process of protein synthesis directed by $mRNA$ templates, occurring through the sequential phases of amino acid charging, initiation, elongation via peptide bond formation, and termination mediated by release factors.

Step 1: Analyzing the Template Strand and Complementary Pairing

The given DNA sequence represents a single strand with a 5' to 3' polarity:

Template Strand: 5'- ATGCATGCATGCATGCATGCATGCATGC -3'

According to the Watson-Crick Base Pairing Rules [per Chargaff’s Rules and the Double Helix Model], adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C) via hydrogen bonding.

Step 2: Determining the Complementary Strand (3' to 5')

Because DNA strands are antiparallel [as necessitated by the phosphodiester backbone orientation], if the template strand runs 5' to 3', the complementary strand must run 3' to 5'.

Complementary sequence (3' to 5'):

3'- TACGTACGTACGTACGTACGTACGTACG -5'

Step 3: Reversing the Sequence to 5' to 3' Direction

The question requires the complementary strand sequence specifically in the 5' to 3' direction. We must reverse the sequence derived in Step 2 to establish the correct polar reading.

Visual Representation of DNA Polarity

Final Solution: The sequence of the complementary strand in the 5' to 3' direction is 5'- GCATGCATGCATGCATGCATGCATGCAT -3'

Theoretical Foundation of Translation

Translation is the biological process by which the sequence of nucleotides in messenger RNA (mRNA) is converted into a specific sequence of amino acids to form a polypeptide chain. This process occurs in the cytoplasm on structures called ribosomes. The synthesis follows the directionality $5' \rightarrow 3'$ on the mRNA, corresponding to the $N$-terminus to $C$-terminus direction of the polypeptide.

Step 1: Activation of Amino Acids

Before translation begins, amino acids must be activated in the presence of $ATP$ and linked to their cognate $tRNA$. This process, known as aminoacylation of tRNA (or charging of $tRNA$), is catalyzed by the enzyme aminoacyl-tRNA synthetase.
Reaction: $\text{Amino Acid} + ATP + tRNA \xrightarrow{\text{synthetase}} \text{Aminoacyl-tRNA} + AMP + PPi$ [Per the principle of enzymatic specificity].

Step 2: Initiation

The small subunit of the ribosome binds to the mRNA at the initiation codon (AUG). The initiator $tRNA$ carrying methionine ($fMet$ in prokaryotes) binds to the $P$-site of the ribosome. Subsequently, the large ribosomal subunit joins the complex, forming a functional $70S$ (or $80S$) initiation complex [Reference: The Ribosome Cycle].

Step 3: Elongation

The elongation cycle consists of three repeating steps:

• Codon Recognition: A new aminoacyl-$tRNA$ enters the $A$-site, where its anticodon base-pairs with the mRNA codon [Per Watson-Crick base pairing].
• Peptide Bond Formation: The enzyme peptidyl transferase (a ribozyme component of the large subunit) catalyzes the formation of a peptide bond between the amino acid at the $P$-site and the amino acid at the $A$-site.
• Translocation: The ribosome shifts by one codon ($3$ nucleotides) toward the $3'$ end of the mRNA. The empty $tRNA$ moves to the $E$-site and exits, while the peptidyl-$tRNA$ moves to the $P$-site.

Step 4: Termination

Termination occurs when a stop codon (UAA, UAG, or UGA) enters the $A$-site. These codons are not recognized by any $tRNA$ but are recognized by Release Factors. These factors bind to the stop codon, causing the release of the polypeptide chain and the dissociation of the ribosomal subunits from the mRNA.

Summary of Translation Components

Final Solution: Translation is the mechanism of protein synthesis where the genetic information stored in mRNA is decoded into a sequence of amino acids via tRNA adaptors on the ribosome, resulting in the formation of a functional polypeptide chain.

Given Variables & Initial Setup

According to Chargaff’s Rules for double-stranded DNA, the total amount of purines equals the total amount of pyrimidines, and specific base pairing follows the equivalence: $[A] = [T]$ and $[G] = [C]$.

• Percentage of Cytosine ($C$) = $20\%$
• Total percentage of all bases ($A + T + G + C$) = $100\%$

Step 1: Applying Chargaff’s Equivalence Principle

Since the DNA is double-stranded, the concentration of Guanine ($G$) must be equal to the concentration of Cytosine ($C$).

$[G] = [C] = 20\%$ [Per Chargaff’s Rule of base equivalence]

Step 2: Calculating Combined Percentage of Purines and Pyrimidines

Calculate the total percentage occupied by Guanine and Cytosine:

$[G] + [C] = 20\% + 20\% = 40\%$

Step 3: Deriving the Percentage of Adenine and Thymine

Subtract the $G-C$ content from the total composition to find the remaining percentage for Adenine ($A$) and Thymine ($T$):

$[A] + [T] = 100\% - ([G] + [C])$

$[A] + [T] = 100\% - 40\% = 60\%$

Step 4: Isolating Adenine

Since $[A] = [T]$ [Per Chargaff’s Rule], we can substitute $[T]$ with $[A]$ in the equation:

$[A] + [A] = 60\%$

$2[A] = 60\%$

$[A] = \frac{60\%}{2} = 30\%$

Visual Representation of DNA Composition

Final Solution: The percentage of adenine in the DNA is 30%.

1. Definition and Core Theoretical Foundation

Bioinformatics is an interdisciplinary field that develops methods and software tools for understanding biological data, particularly when the data sets are large and complex. It functions as the nexus of Molecular Biology, Computer Science, Information Engineering, Mathematics, and Statistics.

In the context of the Molecular Basis of Inheritance, bioinformatics is primarily concerned with the storage, retrieval, analysis, and interpretation of biological sequences, such as nucleic acids ($DNA$, $RNA$) and protein sequences.

2. Key Functional Domains

The application of bioinformatics in modern genetics can be categorized into three sequential tiers:

• Data Storage and Curation: Creation of massive biological databases (e.g., NCBI GenBank, EMBL, DDBJ) to store genomic sequences and proteomic data.
• Computational Analysis: Use of algorithms to perform sequence alignment, motif discovery, and structural prediction of proteins.
• Systems Biology Interpretation: Integrating genomic data to understand metabolic pathways and gene regulatory networks [Per the Central Dogma of Molecular Biology].

3. Mathematical & Algorithmic Principles

Bioinformatics relies on advanced algorithms to compare sequences. The fundamental process involves dynamic programming to determine the "edit distance" or similarity score between two strands of nucleotides.

The sequence alignment score ($S$) is generally computed as:

$S = \sum (matches) - \sum (mismatches) - \sum (gaps)$

This allows scientists to deduce evolutionary relationships (phylogeny) and locate functional domains within a chromosome [By Principle of Homology].

4. Visualizing Sequence Alignment

5. Comparative Analytical Matrix

6. Summary of Significance

Bioinformatics is indispensable for the Molecular Basis of Inheritance because the sheer volume of data generated by Next-Generation Sequencing (NGS) cannot be processed by human cognition alone. It enables the identification of genetic variations, such as Single Nucleotide Polymorphisms ($SNPs$), which are critical for diagnosing hereditary diseases and developing personalized medical treatments [Per the principles of Pharmacogenomics].

Final Solution: Bioinformatics is the application of computational tools and statistical methods to manage, analyze, and interpret massive biological datasets, specifically enabling the mapping and functional annotation of DNA, RNA, and protein sequences within the field of genetics.

Definition and Theoretical Foundation

In the process of DNA-dependent RNA transcription, the double-stranded DNA molecule serves as the template for synthesizing a complementary RNA strand. Because RNA polymerase synthesizes RNA only in the $5' \to 3'$ direction [Per the polarity constraints of the enzyme], the two strands of the DNA double helix play distinct roles based on their orientation.

Comparative Analytical Table

Step 1: Visual Representation of Transcription Polarity

Step 2: Molecular Justification

• Template Strand (Antisense Strand): This strand is read by RNA polymerase in the $3' \to 5'$ direction. By the principle of complementary base pairing [Chargaff’s Rules applied to Transcription], the RNA strand synthesized will be complementary to the template. For example, if the template contains $3'-TAC-5'$, the mRNA will be $5'-AUG-3'$.
• Coding Strand (Sense Strand): This strand is not used as a template for transcription. However, it is labeled "coding" because its sequence is essentially identical to the mRNA transcript, substituting Thymine ($T$) with Uracil ($U$). This correspondence allows scientists to predict the mRNA sequence directly from the coding strand of the genomic DNA.

Final Solution: The template strand serves as the physical blueprint for mRNA synthesis through complementary base pairing (running $3' \to 5'$), whereas the coding strand runs $5' \to 3'$ and mirrors the sequence of the resulting mRNA transcript, thereby serving as the reference strand for determining genetic information.

Definition and Theoretical Foundation

Polymorphism, in the context of molecular genetics, refers to the occurrence of two or more clearly different morphs or alleles in the population of a species such that the frequency of even the rarest allele is greater than 0.01 (1%). [Per Population Genetics Principles]. It is essentially a variation at the genetic level, arising from mutations in the non-coding sequences of DNA.

Mechanism of DNA Polymorphism

The genetic basis for polymorphism lies in the accumulation of mutations in the germ cells. Since these mutations occur in non-coding DNA sequences, they do not undergo selection pressure and tend to accumulate over generations. This leads to a high degree of variation in the nucleotide sequence of the genome across individuals. These variations are often termed as DNA Polymorphism.

Types of Polymorphism

Polymorphism can range from a single nucleotide change to very large-scale variations. The primary classifications are:

• Single Nucleotide Polymorphism (SNP): A variation at a single position in a DNA sequence among individuals.
• Variable Number Tandem Repeats (VNTRs): A type of satellite DNA where short nucleotide sequences are arranged in tandem and repeat a variable number of times.

Visual Representation of VNTR Polymorphism

Applications in Genomic Analysis

Final Solution: Polymorphism represents the inherited genetic variation within a population, primarily occurring in non-coding DNA. These variations, particularly VNTRs and SNPs, act as biological markers that facilitate DNA fingerprinting, identification of disease-linked genes, and the study of evolutionary trajectories of species.

1. Definitions and Fundamental Nature

The distinction between Repetitive DNA and Satellite DNA is rooted in the architecture of the eukaryotic genome and the density-gradient centrifugation profiles of nuclear DNA.

• Repetitive DNA: These are sequences of DNA that are repeated many times throughout the genome, ranging from a few times to millions of copies. They can be categorized into tandem repeats (clustered together) or interspersed repeats (transposable elements distributed throughout). [Per the Human Genome Project findings on non-coding regulatory sequences].
• Satellite DNA: This is a specific subset of repetitive DNA consisting of short, highly repetitive sequences (often 2–100 base pairs) arranged in tandem arrays. These sequences have a different base composition (GC/AT ratio) than the bulk genomic DNA, allowing them to form distinct "satellite" bands when subjected to density-gradient centrifugation.

2. Comparative Analytical Table

3. Structural Visualization

4. Theoretical Justification

The distinction is fundamentally based on Buoyant Density. Satellite DNA is characterized by high rates of polymorphism. Because these sequences do not code for proteins [Per the Central Dogma constraints], high mutation rates are tolerated, leading to a high degree of variation in the number of copies between individuals. This variation is the basis for DNA Fingerprinting (VNTRs—Variable Number Tandem Repeats). In contrast, "Repetitive DNA" is an umbrella term; if a repetitive element is transcribed (like some mobile genetic elements), its structural constraints are much stricter.

Final Solution: Repetitive DNA represents a broad classification of all repeated sequences in the genome, which may be scattered or clustered. Satellite DNA is a specific, restricted subset of repetitive DNA that is arranged in tandem arrays, possesses a distinct buoyant density from bulk genomic DNA, and is concentrated in highly condensed heterochromatic regions.

1. Conceptual Definitions

In the context of the human genome, the majority of DNA sequences are unique; however, a significant portion consists of non-coding sequences that recur multiple times. These are classified based on their functional and physical properties.

• Repetitive DNA: These are sequences of DNA that are repeated many times, sometimes hundreds to thousands of times, throughout the genome. They may be clustered (tandem repeats) or interspersed throughout the genome.
• Satellite DNA: A specific subclass of repetitive DNA that consists of highly repetitive nucleotide sequences that do not code for proteins. These sequences are clustered in specific regions of the chromosome, particularly at the centromeres and telomeres.

2. Comparative Analysis Table

3. Physiological and Genetic Significance

Repetitive DNA [Per Genomic Stability Theory]: Much of the dispersed repetitive DNA consists of mobile genetic elements (transposons). These play a role in genome evolution by promoting chromosomal rearrangements and mutations, which contribute to genetic diversity.

Satellite DNA [Per Cytogenetic Function]: Satellite DNA, particularly in the form of microsatellites and minisatellites, is characterized by a high degree of polymorphism. Because the number of repeats varies significantly between individuals, this DNA is the foundation for DNA Fingerprinting [Reference: Alec Jeffreys, 1984]. These sequences are essential for structural integrity of chromosomes during mitosis and meiosis.

4. Visual Representation of Genomic Fractionation

Final Solution: While all Satellite DNA is repetitive, not all Repetitive DNA is Satellite DNA. Repetitive DNA acts as a broad category including dispersed functional and non-functional elements, whereas Satellite DNA represents highly dense, tandemly clustered, non-coding, and polymorphic sequences identified by their specific buoyant density in the genome.

Theoretical Framework: Structural and Functional Role of tRNA

Transfer RNA ($tRNA$), also colloquially referred to as "adapter molecule" [per Francis Crick’s Adaptor Hypothesis], acts as the physical bridge between the mRNA nucleotide sequence and the amino acid sequence of a polypeptide chain.

Step 1: Identifying the Functional Mechanics

The primary functions of $tRNA$ are executed through two specific structural sites: the anticodon loop and the 3'-acceptor stem.

• Anticodon recognition: The $tRNA$ contains an anticodon sequence complementary to the mRNA codon, ensuring specific base pairing [per the Wobble Hypothesis and Watson-Crick base pairing rules].
• Amino acid delivery: The 3'-terminal hydroxyl ($OH$) group of the acceptor stem is covalently linked to a specific amino acid [catalyzed by aminoacyl-tRNA synthetase], which is then delivered to the ribosomal $A$-site during translation.

Visual Representation of tRNA Structure

Synthesis of Function

The $tRNA$ serves as an adapter molecule that reads the genetic code on mRNA through its anticodon and translates it into a specific amino acid sequence by transporting the corresponding activated amino acids to the ribosome during protein synthesis.

Final Solution: $tRNA$ functions as an adapter molecule that specifically recognizes mRNA codons via its anticodon and delivers the corresponding amino acids to the ribosome for peptide bond synthesis.

Step 1: Theoretical Foundation of the Hershey-Chase Experiment

The Hershey-Chase experiment (1952) sought to determine whether $DNA$ or protein was the hereditary material transmitted by the bacteriophage $T2$ to its host, Escherichia coli. They utilized the fundamental biochemical differences between the molecular compositions of these two biomolecules:

• DNA: Contains Phosphorus ($P$) in its phosphodiester backbone but lacks Sulfur ($S$).
• Proteins: Contain Sulfur ($S$) in amino acids like cysteine and methionine but lack Phosphorus ($P$).

Step 2: Differential Radioactive Labeling

To distinguish between the two, Hershey and Chase cultivated viruses in two separate media containing radioisotopes:

[Justification: Per the selective incorporation of elements into specific molecular structures, radioactive decay tracking allows for the spatial localization of these isotopes within the host-virus system.]

Step 3: Infection, Blending, and Centrifugation

The experiment proceeded through three critical physical phases:

1. Infection: Labeled phages were allowed to infect non-radioactive E. coli cells.
2. Blending: A blender was used to agitate the culture, mechanically shearing the viral protein coats (ghosts) from the surfaces of the bacterial cells.
3. Centrifugation: The mixture was spun in a centrifuge. The heavier bacterial cells formed a pellet at the bottom, while the lighter viral protein coats remained in the supernatant.

Step 4: Analytical Data Interpretation

The results provided definitive evidence based on the localization of the radioisotopes:

• Supernatant Analysis: The radioactive sulfur ($^{35}S$) was found in the supernatant. [Conclusion: The viral protein coat did not enter the bacterial cell.]
• Pellet Analysis: The radioactive phosphorus ($^{32}P$) was found in the bacterial pellet. [Conclusion: The viral $DNA$ entered the bacterial cell to direct the synthesis of new progeny viruses.]

Step 5: Theoretical Synthesis

The experiment established that the genetic information required for viral replication was contained within the $DNA$ molecule, as only the radioactive $DNA$ was detected within the host cell post-infection. This confirmed the Central Dogma's premise regarding the hereditary molecule's identity [By the Hershey-Chase Conclusion].

Final Solution: Hershey and Chase differentiated DNA from protein by selectively labeling them with radioactive isotopes ($^{32}P$ for DNA and $^{35}S$ for protein). By observing that only $^{32}P$ entered the host bacteria while $^{35}S$ remained outside in the protein coat, they demonstrated that DNA, not protein, is the hereditary material.

Definition and Functional Analysis of Exons

Exons are the specific segments of a eukaryotic gene that are transcribed into primary RNA (pre-mRNA) and remain present in the mature, processed messenger RNA (mRNA) after the non-coding intervening sequences, known as introns, have been removed via the process of splicing.

Functional Role:

• Protein Coding: Exons contain the open reading frame (ORF) and regulatory sequences that dictate the specific amino acid sequence of the final polypeptide chain during the process of translation. [Per the Central Dogma of Molecular Biology].
• Modular Evolution: Through the mechanism of exon shuffling, exons can be rearranged to create new protein variants with novel functional domains, facilitating structural and evolutionary diversity. [Per Evolutionary Molecular Biology].

Visual Representation of Exon-Intron Organization

Summary of Molecular Significance:

The sequence of exons in the mature mRNA ensures the collinearity between the genetic information preserved in the transcript and the primary structure of the functional protein. Any mutation within an exon (e.g., missense or nonsense mutation) directly alters the amino acid sequence, potentially disrupting protein function. [Per the Genetic Code Hypothesis].

Final Solution: Exons function as the coding segments of a gene that are retained in mature mRNA to provide the genetic instructions for protein synthesis.

Step 1: Identifying the Polarity of the Given DNA Strand

The given sequence is provided as:
Template Strand ($S_1$): 5'- A T G C A T G C A T G C A T G C A T G C A T G C A T G C -3'
[Per the antiparallel nature of the DNA double helix, the complementary strand ($S_2$) must possess 3' to 5' orientation relative to $S_1$.]

Step 2: Applying Chargaff’s Base-Pairing Rules

According to the Watson-Crick base-pairing principle:

• Adenine ($A$) pairs with Thymine ($T$) via two hydrogen bonds.
• Thymine ($T$) pairs with Adenine ($A$) via two hydrogen bonds.
• Guanine ($G$) pairs with Cytosine ($C$) via three hydrogen bonds.
• Cytosine ($C$) pairs with Guanine ($G$) via three hydrogen bonds.

Step 3: Generating the Complementary Strand (3' to 5')

Aligning the nucleotides according to the pairing rules for the 3' to 5' strand:
Given 5': A T G C A T G C A T G C A T G C A T G C A T G C A T G C :3'
Comp 3': T A C G T A C G T A C G T A C G T A C G T A C G T A C G :5'

Step 4: Reorienting the Complementary Strand to 5' → 3'

The question requires the complementary strand to be written in the 5' → 3' direction. To achieve this, we reverse the sequence obtained in Step 3:
Original 3' → 5' sequence: $T-A-C-G-T-A-C-G-T-A-C-G-T-A-C-G-T-A-C-G-T-A-C-G-T-A-C-G$
Reversed 5' → 3' sequence: $G-C-A-T-G-C-A-T-G-C-A-T-G-C-A-T-G-C-A-T-G-C-A-T-G-C-A-T$

Visualization of Base Pairing

Final Solution: The complementary strand in the 5' → 3' direction is: 5'- GCATGCATGCATGCATGCATGCATGCAT -3'

Definition and Theoretical Foundation

DNA fingerprinting (also known as DNA profiling or DNA typing) is a laboratory technique used to identify an individual by examining variations in their genetic material. It is based on the identification of Variable Number Tandem Repeats (VNTRs), which are short, specific sequences of non-coding DNA that repeat multiple times at various loci within the genome [Per the principle of genetic polymorphism].

Step 1: The Principle of VNTRs

The human genome consists of approximately $99.9\%$ identical sequences across all individuals. The remaining $0.1\%$ exhibits sequence variation, specifically in regions known as minisatellites or VNTRs. Since these repeats vary in number and length between individuals, they serve as unique molecular markers [Ref: Jeffreys et al., 1985].

Step 2: The Process of DNA Fingerprinting

• Isolation: Extraction of high-molecular-weight genomic DNA from a biological sample (e.g., blood, hair follicles, semen).
• Digestion: The DNA is cleaved into fragments using Restriction Endonucleases [By the mechanism of site-specific hydrolysis].
• Separation: Fragments are separated by size using Gel Electrophoresis (typically agarose gel), where smaller fragments migrate faster towards the anode.
• Southern Blotting: The separated DNA fragments are transferred onto a synthetic membrane (nylon or nitrocellulose).
• Hybridization: The membrane is incubated with radioactive or fluorescently labeled VNTR probes that bind specifically to complementary sequences.
• Detection: The pattern is visualized via Autoradiography, revealing bands that constitute the "fingerprint."

Visual Representation of DNA Fingerprinting Pattern

Applications of DNA Fingerprinting

Final Solution: DNA fingerprinting is a technique that analyzes specific repetitive DNA sequences (VNTRs) to establish a unique genetic identity for an individual. Its primary applications include forensic science, solving paternity disputes, studying population genetics, and clinical diagnostics.

Step 1: Theoretical Foundation: Chargaff’s Rules

According to Chargaff’s Rules for double-stranded DNA (dsDNA), the amount of purines is equal to the amount of pyrimidines. Specifically, the base pairing follows the principle of complementarity: Adenine ($A$) pairs with Thymine ($T$), and Cytosine ($C$) pairs with Guanine ($G$). Therefore, the molar ratios are defined by the following equations [Per Chargaff’s Rule]:

• $A = T$
• $C = G$
• $A + T + C + G = 100\%$

Step 2: Assigning Given Variables

Given the percentage of Cytosine ($C$) in the DNA molecule:

$C = 20\%$

Based on the complementary base-pairing rule ($C = G$), we can derive the percentage of Guanine:

$G = 20\%$

Step 3: Calculating Total Purine and Pyrimidine Content

Since the total composition of nitrogenous bases in the DNA molecule must equal $100\%$, we establish the following summation:

$(A + T) + (C + G) = 100\%$

Substitute the known values of $C$ and $G$ into the equation:

$(A + T) + (20\% + 20\%) = 100\%$

$(A + T) + 40\% = 100\%$

$(A + T) = 100\% - 40\% = 60\%$

Step 4: Determining the Percentage of Adenine

Per the rule of complementarity, $A = T$. Therefore, we can express the sum $(A + T)$ as $2A$:

$2A = 60\%$

$A = \frac{60\%}{2}$

$A = 30\%$

Visual Representation of Base Composition

Final Solution: The percentage of Adenine in the DNA is 30%.

1. Foundational Basis: The Complementary Nature of Nitrogenous Bases

The hypothesis of semi-conservative DNA replication proposed by James Watson and Francis Crick (1953) was fundamentally derived from the structural property of base pairing complementarity inherent in the DNA double helix model.

According to the Watson-Crick model, the DNA molecule consists of two antiparallel strands coiled around a common axis. The stability and specificity of this structure are maintained by hydrogen bonding between specific nitrogenous bases:

• Adenine ($A$) pairs with Thymine ($T$) via two hydrogen bonds.
• Guanine ($G$) pairs with Cytosine ($C$) via three hydrogen bonds.

2. The Logic of Semi-Conservative Replication

Watson and Crick noted that if the sequence of bases on one strand is known, the sequence on the opposite strand is automatically determined by the base-pairing rules [Per Chargaff’s Rules: $\frac{A+G}{T+C} = 1$].

The semi-conservative hypothesis posits that during replication, the two strands of the parental double helix separate, and each strand acts as a template for the synthesis of a new, complementary strand. Consequently, each daughter DNA molecule consists of one "old" (parental) strand and one "newly synthesized" strand.

3. Mechanistic Justification

The mechanism relies on the Physical Separation of Strands and Template-Directed Synthesis:

4. Experimental Verification (Historical Context)

While Watson and Crick proposed this based on structure, the hypothesis was later experimentally confirmed by Meselson and Stahl (1958) using ${}^{15}N$ isotope labeling in Escherichia coli. They observed that after one generation of replication in a ${}^{14}N$ medium, all DNA molecules were of intermediate density, confirming that each daughter DNA molecule contained one original heavy strand and one new light strand [Ref: Density Gradient Centrifugation].

Final Solution: The property of base-pairing complementarity between the two strands of the DNA double helix led Watson and Crick to propose the semi-conservative mode of replication, as it provides a mechanism where each strand can act as a template for synthesizing its precise complement.

Step 1: Structural Basis of Ribosomal Functionality

The ribosome acts as a complex molecular machine consisting of catalytic $rRNA$ molecules and structural proteins. During the process of translation, the ribosome exists as two subunits: the $30S$ (small) subunit and the $50S$ (large) subunit in prokaryotes, which assemble on the $mRNA$ template. Its primary roles are defined by its ability to facilitate the precise decoding of genetic information [Per the Central Dogma of Molecular Biology].

Step 2: Role 1 – Decoding and Alignment of Aminoacyl-tRNA

The ribosome serves as a physical scaffold that positions the $mRNA$ transcript and the aminoacyl-$tRNA$ molecules in a specific spatial orientation.

• Codon-Anticodon Pairing: The small subunit holds the $mRNA$ codon in place, ensuring that the complementary anticodon of the $tRNA$ binds accurately [By the principle of complementary base pairing].
• The A, P, and E Sites: The ribosome creates three distinct binding sites—the $A$ (aminoacyl) site, the $P$ (peptidyl) site, and the $E$ (exit) site—which govern the order of amino acid addition.

Step 3: Role 2 – Peptidyl Transferase Activity (Catalysis)

The ribosome acts as a ribozyme, specifically utilizing the $23S$ $rRNA$ (in prokaryotes) or $28S$ $rRNA$ (in eukaryotes) to catalyze the formation of peptide bonds between amino acids.

The reaction can be expressed as: $Peptidyl\text{-}tRNA + Aminoacyl\text{-}tRNA \xrightarrow{Ribozyme} Peptidyl\text{-}tRNA_{n+1} + tRNA_{empty}$

This activity ensures that the polypeptide chain grows in a linear, sequential manner dictated by the sequence of codons [Per the mechanism of ribosomal catalysis].

Visual Representation of Ribosomal Translation

Summary of Functional Roles

Final Solution: The two essential roles of the ribosome are: (1) acting as a molecular scaffold to facilitate the accurate pairing of $mRNA$ codons with $tRNA$ anticodons, and (2) functioning as a ribozyme (peptidyl transferase) to catalyze the formation of peptide bonds between successive amino acids in a polypeptide chain.

Step 1: Structural and Functional Definition of the Ribosome

The ribosome is a complex macromolecular machine composed of ribosomal RNA (rRNA) and various proteins. During the process of protein synthesis (translation), it functions as the site where genetic information stored in messenger RNA (mRNA) is decoded into a polypeptide chain [Per the Central Dogma of Molecular Biology].

Step 2: Role 1 - mRNA Decoding and tRNA Alignment

The ribosome facilitates the interaction between the mRNA codon and the anticodon of the transfer RNA (tRNA) charged with a specific amino acid. The small subunit of the ribosome acts as a structural scaffold that maintains the alignment of the mRNA molecule. As the mRNA moves through the ribosome, the small subunit ensures that only the tRNA with the complementary anticodon binds to the A-site (aminoacyl site), thereby ensuring the high-fidelity translation of the genetic code into a specific amino acid sequence [By the principle of codon-anticodon base pairing].

Step 3: Role 2 - Peptidyl Transferase Activity (Catalysis)

The large subunit of the ribosome contains the catalytic center responsible for the formation of peptide bonds. This function is performed by the $23S$ rRNA (in prokaryotes) or $28S$ rRNA (in eukaryotes), which functions as a ribozyme. The ribosome positions the amino acid attached to the tRNA in the P-site (peptidyl site) and the new amino acid in the A-site in close proximity to catalyze the nucleophilic attack of the amino group on the ester bond, resulting in the elongation of the polypeptide chain [Per the Peptidyl Transferase reaction mechanism].

Visual Representation of Ribosomal Translation Sites

Summary of Functional Roles

Final Solution: The two essential roles of the ribosome during translation are: 1) Acting as a scaffold to facilitate the accurate pairing of mRNA codons with tRNA anticodons, and 2) Providing the peptidyl transferase ribozyme activity necessary to catalyze the formation of peptide bonds between successive amino acids in the polypeptide chain.

Definition and Scope of the Human Genome Project (HGP)

The Human Genome Project (HGP), initiated in 1990 and completed in 2003, is classified as a "mega project" due to the unprecedented scale of its technical, biological, and computational requirements. The project aimed to determine the complete nucleotide sequence of the human genome, comprising approximately $3.3 \times 10^9$ base pairs.

Analytical Criteria for the Mega Project Designation

Step 1: Genomic Magnitude and Resource Allocation

The human genome consists of $\approx 3.3$ billion base pairs. If one were to store this information in books, each containing 1000 pages and each page containing 1000 letters, the project would necessitate 3300 such volumes. [Per the HGP documentation]. This magnitude necessitated a global collaborative effort involving the U.S. Department of Energy (DOE) and the National Institutes of Health (NIH), alongside international partners in the UK, France, Germany, Japan, and China.

Step 2: Computational and Bioinformatics Integration

The sheer volume of data generated is beyond human manual processing capability. The project birthed the field of Bioinformatics, which uses computer-based software and algorithms to store, retrieve, and analyze biological data. The dependency on advanced computational infrastructure to handle sequence alignment and gene identification is a primary justification for its "mega" status.

Step 3: Ethical, Legal, and Social Implications (ELSI)

A mega project is defined not only by its technical output but by its societal impact. HGP addressed the ethical, legal, and social issues (ELSI) concerning the manipulation of genetic information, data privacy, and the potential for discrimination based on genetic profiles. Establishing international guidelines for these complex interdisciplinary challenges was a monumental task.

Visual Representation of HGP Data Management

Conclusion on Academic Justification

The HGP is termed a "mega project" because it combined high-throughput sequencing technologies with massive computational power and international human resource coordination. It transformed biology into an information science, establishing a massive reference dataset for understanding human evolution, disease susceptibility, and personalized medicine.

Final Solution: The Human Genome Project is defined as a mega project due to its massive scale ($3.3 \times 10^9$ base pairs), its substantial financial requirement (US $3$ billion), the necessity for high-performance bioinformatics to manage colossal datasets, and the broad international cooperation required to address the profound technical and ethical challenges of genome sequencing.

Theoretical Foundation of mRNA Transcription

In the process of transcription, the DNA double helix consists of two strands: the coding strand (also known as the non-template or sense strand) and the template strand (also known as the antisense or non-coding strand). The RNA polymerase enzyme synthesizes mRNA using the template strand as a guide, following the principle of complementary base pairing [Per the Central Dogma of Molecular Biology].

Step 1: Identifying the Relationship Between Strands

The coding strand has the same polarity and base sequence as the mRNA molecule, with the critical exception that thymine ($T$) in DNA is replaced by uracil ($U$) in RNA [Per the Rules of Genetic Transcription].

• Coding Strand: $5'-ATGCATGCATGCATGCATGCATGCATGC-3'$
• Template Strand: $3'-TACGTACGTACGTACGTACGTACGTACG-5'$ (Complementary to Coding)
• mRNA Sequence: Synthesized from the template strand, which results in a sequence identical to the coding strand, substituting $T$ with $U$.

Step 2: Performing the Sequence Conversion

The transcription process maps DNA bases to RNA bases according to the following mapping: $A \to A$, $T \to U$, $G \to G$, and $C \to C$.

Visual Representation of Transcriptional Flow

Conclusion

By applying the substitution rule where $T$ in the coding strand is replaced by $U$ in the mRNA molecule, the resulting sequence is derived directly from the provided template.

Final Solution: The sequence of the mRNA is 5'-AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3'